Polymorphic Tandem repeat loci for Yersinia pestis typing
Three groups have evaluated tandem repeat loci for typing Y. pestis. These studies were reported in Le Flèche et al. 2001, Klevytska et al., 2001, Li et al., 2013 and evaluated in a number of publications in the past few years.
The first report and subsequent work described 25 loci. The second report and associated work corresponds to 43 loci.
Six loci are shared in these two sets (as shown in Pourcel et al., 2004), markers ypms04, ypms05, ypms07, ypms20, ypms45 and ypms62 in Le Flèche et al., 2001 correspond respectively to markers M58, M59, M37, M51, M42 and M34 in Klevytska et al., 2001.
ypms04 = M58
ypms05 = M59
ypms07 = M37
ypms20 = M51
ypms45 = M42
ypms62 = M34
Altogether 88 loci are currently available for MLVA typing (Li et al., 2013). This is too much for routine analysis using currently available technologies, and probably not necessary. Panels of selected loci have been proposed, and it is likely that different selections may be designed according to specific purposes. The smallest such panel comprises seven loci, ms01, ms04, ms06, ms07, ms46, ms62, ms70 and is called MLVA7.
It is important to keep in mind that when merging data from different publications, it is essential to check the allele convention used in each report, since there is not yet an agreement on this ; this can be done if the authors indicated how they would call alleles in a published genome sequence ; CO92 (genome accession number NC_003143) is used as reference.
The Yersinia pestis database hosted by MicrobesGenotyping compiles data from the literature. It also presents data deduced from in silico analysis of available genome sequence for all 88 VNTR loci.
Improved primer set for typing ms46 and ms62 : For easier typing on agarose gels, an alternative set of primers is suggested for these two loci (if using higher resolution aparatus the initial set published in Le Flèche et al., 2001 can still be used).
ms46 (repeat unit 7bp expected product size in CO92 112bp corresponds to 5U) primer set version 2 :
TAGACTTTACTCGCGGCTAGCTTT
ATAATGTTAGTGGCGAGTCGTCAA
(observed allele size range 100 to 230 bp, unit size 7bp)
ms62 (repeat unit 9bp expected product size 124bp in CO92, corresponds to 7U) :
GCGGGTTGACGCTGTTGAGCAAC
TTGTTCTTGAGCCGCTACCGGGAT
(observed allele size range : 100 to 300 bp, unit size 9 bp)
Last edited june 2016
